Pseudogenes & Mutation analysis

Pseudogenes of ABCD1 and the importance for genetic analysis

Stephan Kemp, Ph.D

Mutational analysis of the ABCD1 gene has the potential to identify women who are heterozygous for adrenoleukodystrophy with virtually complete accuracy. However, sequencing is complicated by the existence of autosomal paralogs.

The ALD gene is located on the X-chromosome at location Xq28. The gene contains 10 exons and covers approximately 21 kb. Sequence analysis of genomic DNA is made difficult because of the presence of ABCD1 paralogs on four autosomes (Figure). At some moment in primate evolution (about 5-10 million years ago), a 9.7 kb DNA segment encompassing exons 7 through 10 of the ABCD1 gene was duplicated from the X-chromosome to the chromosomes 2 (2p11), 10 (10p11), 16 (16p11) and 22 (22q11). In 1997, Eichler and colleagues at the Human Genome Center (Livermore, Ca) performed comparative sequence analysis of this fragment and showed that these four paralogs share 92-96% nucleotide identity. For details, please follow this link.Picture taken from Eichler et al. Interchromosomal duplications of the adrenoleukodystrophy locus: a phenomenon of pericentromeric plasticity (1997) Hum Mol Genet 6: 991-1002.

Because of this very high homology between the pseudogenes and the ABCD1 gene, great care should be taken when mutation analysis using genomic DNA is set up. In 1999, Corinne Boehm and colleagues from the Institute of Genetic Medicine at Johns Hopkins University (Baltimore, MD) developed and validated a robust genomic DNA-based diagnostic test for adrenoleukodystrophy. Xq28, ABCD1 gene specific primers were designed (see list below) that allow accurate mutation analysis without interference of the pseudogenes. For more details, please follow this link, or contact us for a copy of the paper.

Below, alignments of the exons 7, 8, 9 and 10 of the ABCD1 gene (Xq28) and the four paralogs on chromosomes 2, 10, 16 and 22 are shown. The asterisks indicate identical nucleotides in all five sequences.

Alignment of exon 7 of the ABCD1 gene with the paralogs.

ABCD1      acactgcctgggaggcgcagagtatcttgggggaggcagagccggcccttccctccgtgg
Chr2       acactgcctgggaggcacagagtatcttgggggaggcagggccagcccttccctccgtgg
Chr10      acactgcctgggaggcgcagagtatctcgggggaggcagggccggcccttccctccgtgg
Chr16      acactgcctgggaggcgcagagtgtcctgggggaggcagggccggcccttccctccatgg
Chr22      acactgcctgggaggcgcagagtatcctgggggaggcagggccggcccttccctccatgg
           **************** ****** **  *********** *** ************ ***
                           1635    .         .         .         .
           ******** **************************** *** **  **************
               .         .         .         .         .         .
           ****************** ***** ****** ****** *********************
               .         .         .         .         .         
           *******  *********  ******* ******* ************************

ABCD1      ctggcagccaccctttgtcccaccctggcctctcccttggcctccagggagtgaagatta
Chr2       ctggcagccgccctttgtcccaccctggcctctcccttggcctccagggagtgaagatta
Chr10      ctggcagccgccctttgtcccaccctggcctctcccttggcctccagggagtgaagatta
Chr16      ctggcagccgccctttgtcccaccctggcctctcccttggcctccagggagtgaagatta
Chr22      ctggcagccgccctttgtcccaccctggcctctcccttggcctccagggagtgaagatta
           ********* **************************************************

Alignment of exon 8 of the ABCD1 gene with the paralogs.

ABCD1      ctccccggctggcccccgggtctgggtgctggtggaactgagccaagaccattgcccccg
Chr2       ctccccggctggaccccaggtctgggtactggtggaactgagccaagaccattgcccctg
Chr10      ctccccggctggcccccaggtctgggtactggtggaactgagccaagaccattgcccctt
Chr16      ctccccggctggcccccaggtctgggtactggtggaactgagccaagaccattgcccctg
Chr22      ctccccggctggcccccaggtctgggtactggtggaactgagccaagaccattgcccctg
           ************ **** ********* ******************************  
             1781        .         .         .         .         .
           ****************************** **  ***** * *****  **********
               .         .         .    
ABCD1      AATCGGCATGGCCCGCATGTTCTACCACAGgtgagcactccgggccggcaggctccctgg 1865
Chr2       AATCGGCATGGCCCGCATGTTCTACCACAGgtgagcactccgggccggcaggctccctgg
Chr10      AATCGGCATGGCCCGCAAGTTCTACCACAGgtgagcactccaggctggcagcctccctgg
Chr16      AATCGGCATGGCCTGCATGTTCTACCACAGgtgagcactccaggctggcaggctccctgg
Chr22      AATCGGCATGGCCTGCATGTTCTACCACAGgtgagcactccaggctggcaggctccctgg
           ************* *** *********************** *** ***** ********

Alignment of exon 9 of the ABCD1 gene with the paralogs.

ABCD1      gggctggggtgttgggccctggagggtgcacagactctcctctcggcccggacccccagG 1866
Chr2       ggactggggtgttgggccctggagggtgcacagactctcctctcggcccggacccccagG
Chr10      gggctggggtgttgggccctggagggtgcacagactcttctctcggaccggacccacagG
Chr16      gggttggggtgttgggccctggagggtgcacagactctcctctcggcccggacccccagG
Chr22      gggttggggtgttgggccctggagggtgcacagactctcctctaggcccggacccccagG
           **  ********************************** **** ** ******** ****
              .         .         .         .         .         .
           ********* ************** ******* **  ***********************
              .         .         .         .         .         .
           ********** ************ ************************* ** ****  *
ABCD1      CTGTGgtaggtgccctgtctccctgcctggggtcggtgggagtggctgcctgaggggagg 1991
Chr2       CTGTGgtaggtgccctgtctccctgcctggggtcagtgggagtggctgcctgaggggagg
Chr10      CTGTGgtaggtgccctgtctccctgcctggggtcagtgggagtggctgcctgaggggagg
Chr16      CTGTGgtaggtgccctgtctcccttcctggggtgagtgggagtggctgcctgaggggagg
Chr22      CTGTGgtaggtgccctgtctcccttcctggggtgagtgggagtggctgcctgaggggagg
           ************************ ********  *************************

Alignment of exon 10 of the ABCD1 gene with the paralogs.

ABCD1      tgcccctgaccctgtccctctcctggccagGAAATACCACACACACTTGCTACAGTTCGA 2021
Chr2       tgcccctgaccctgtccctctcctggccagGGAGTACCACACACACTTGCTACAGTTCGA
Chr10      tgcccctgaccccgtccctctcctggccagGGAGTACCACACACACTTGCTACAGTTCGA
Chr16      tgcccctgaccctgtccctctcctggccagGGAGTACCACACACACTTGCTACAGTTCGA
Chr22      tgcccctgaccctgtccctctcctggccagGGAGTACCACACACACTTGCTACAGTTCGA
           ************ ****************** * **************************
                   .         .         .         .         .         .
           ********* ******************** * *** ** ***  ****** ***** **
                   .         .         .         .         .         .
           ****** *********************** ******************* ** ******
                   .         .         .         .         .         .
           ************ ***************************** **************** 
                   .         .         .        
           *************** ********************** * *** ** ** ****** **

ABCD1 gene specific primers

Exon/s Primer name 5′ -> 3′ Sequence nt Amplicon size (incl M13 tails)

Primer sequences in black are M13F and M13R sequences that are used for sequencing. Nucleotides in green are Xq28, ABCD1 gene, specific. Primers were taken from Boehm et al.: Accurate DNA-based Diagnostic and Carrier Testing for X-linked Adrenoleukodystrophy (1999) Mol Genet Metab 66: 128-136.

Last modified | 2019-04-18