Pseudogenes & Mutation analysis

Pseudogenes of ABCD1 and the importance for genetic analysis

Stephan Kemp, Ph.D

In most cases, ALD is diagnosed biochemically by measuring elevated levels of very long-chain fatty acids (VLCFA) in plasma. This measurement is highly reliable for the diagnosis of male patients. However, care should be taken when VLCFA measurement is used for the identification of females suspected for ALD. Approximately 20% of women with ALD have normal VLCFA levels. A normal VLCFA level thus does not exclude the diagnosis ALD in females.

Mutational analysis of the ABCD1 gene has the potential to identify women who are heterozygous for ALD with virtually complete accuracy. However, the fact that about half of the mutations are pedigree-specific requires screening of the entire gene in an affected male (or obligate carrier) prior to targeted carrier testing for at-risk female relatives.

The gene mutated in ALD (ABCD1) is located on the X-chromosome at location Xq28. The ABCD1 gene contains 10 exons and covers approximately 21 kb. Sequence analysis of genomic DNA is made difficult because of the presence of ABCD1 paralogs on four autosomes (Figure). At some moment in primate evolution (about 5-10 million years ago), a 9.7 kb DNA segment encompassing exons 7 through 10 of the ABCD1 gene was duplicated from the X-chromosome to the chromosomes 2 (2p11), 10 (10p11), 16 (16p11) and 22 (22q11). In 1997, Eichler and colleagues at the Human Genome Center (Livermore, Ca) performed comparative sequence analysis of this fragment and showed that these four paralogs share 92-96% nucleotide identity. For details, please follow this link.Picture taken from Eichler et al. Interchromosomal duplications of the adrenoleukodystrophy locus: a phenomenon of pericentromeric plasticity. (1997) Hum Mol Genet 6: 991-1002.

Because of this very high homology between the pseudogenes and the ABCD1 gene, great care should be taken when mutation analysis using genomic DNA is set up. In 1999, Corinne Boehm and colleagues from the Institute of Genetic Medicine at Johns Hopkins University (Baltimore, MD) developed and validated a robust genomic DNA-based diagnostic test for ALD. Xq28, ABCD1 gene specific primers were designed (see list below) that allow accurate mutation analysis without interference of the pseudogenes. For more details, please follow this link, or contact us for a copy of the paper.

Below, alignments of the exons 7, 8, 9 and 10 of the ABCD1 gene (Xq28) and the four paralogs on chromosomes 2, 10, 16 and 22 are shown. The asterisks indicate identical nucleotides in all five sequences.

Alignment of exon 7 of the ABCD1 gene with the paralogs.

ABCD1      acactgcctgggaggcgcagagtatcttgggggaggcagagccggcccttccctccgtgg
Chr2       acactgcctgggaggcacagagtatcttgggggaggcagggccagcccttccctccgtgg
Chr10      acactgcctgggaggcgcagagtatctcgggggaggcagggccggcccttccctccgtgg
Chr16      acactgcctgggaggcgcagagtgtcctgggggaggcagggccggcccttccctccatgg
Chr22      acactgcctgggaggcgcagagtatcctgggggaggcagggccggcccttccctccatgg
           **************** ****** **  *********** *** ************ ***
                           1635    .         .         .         .
ABCD1      acacccagctttcccacagGCCCTACATGTCTGTGGGCTCCCTGCGTGACCAGGTGATCT 1675
Chr2       acacccagctttcccacagGCCCTACATGTCTGTGGGTTCCTTGTGTGACCAGGTGATCT
Chr10      acacccaggtttcccacagGCCCTACATGTCTGTGGGATCCCTGCGTGACCAGGTGATCT
Chr16      acacccagctttcccacagGCCCTACATGTCTGTGGGTTCCCTGCATGACCAGGTGATCT
Chr22      acacccagctttcccacagGCCCTACATGTCTGTGGGTTCCCTGCATGACCAGGTGATCT
           ******** **************************** *** **  **************
               .         .         .         .         .         .
ABCD1      ACCCGGACTCAGTGGAGGACATGCAAAGGAAGGGCTACTCGGAGCAGGACCTGGAAGCCA 1735
Chr2       ACCCGGACTCAGTGGAGGGCATGCGAAGGAAGGGCTACCCGGAGCAGGACCTGGAAGCCA
Chr10      ACCCGGACTCAGTGGAGGACATGCGAAGGAAGGGCTACTCGGAGCAGGACCTGGAAGCCA
Chr16      ACCCGGACTCAGTGGAGGACATGCGAAGGAACGGCTACTCGGAGCAGGACCTGGAAGCCA
Chr22      ACCCGGACTCAGTGGAGGACATGCGAAGGAACGGCTACTCGGAGCAGGACCTGGAAGCCA
           ****************** ***** ****** ****** *********************
               .         .         .         .         .         
ABCD1      TCCTGGACGTCGTGCACCTGCACCACATCCTGCAGCGGGAGGGAGgtaggaggcctgggg 1780
Chr2       TCCTGGACATCGTGCACCTGCACCACATCCTGCAGTGGGAGGGAGgtaggaggcctgggg
Chr10      TCCTGGATATCGTGCACCCACACCACATCCTGCAGTGGGAGGGAGgtaggaggcctgggg
Chr16      TCCTGGACATCGTGCACCCGCACCACACCCTGCAGCGGGAGGGAGgtaggaggcctgggg
Chr22      TCCTGGACATCGTGCACCCGCACCACACCCTGCAGCGGGAGGGAGgtaggaggcctgggg
           *******  *********  ******* ******* ************************

ABCD1      ctggcagccaccctttgtcccaccctggcctctcccttggcctccagggagtgaagatta
Chr2       ctggcagccgccctttgtcccaccctggcctctcccttggcctccagggagtgaagatta
Chr10      ctggcagccgccctttgtcccaccctggcctctcccttggcctccagggagtgaagatta
Chr16      ctggcagccgccctttgtcccaccctggcctctcccttggcctccagggagtgaagatta
Chr22      ctggcagccgccctttgtcccaccctggcctctcccttggcctccagggagtgaagatta
           ********* **************************************************

Alignment of exon 8 of the ABCD1 gene with the paralogs.

ABCD1      ctccccggctggcccccgggtctgggtgctggtggaactgagccaagaccattgcccccg
Chr2       ctccccggctggaccccaggtctgggtactggtggaactgagccaagaccattgcccctg
Chr10      ctccccggctggcccccaggtctgggtactggtggaactgagccaagaccattgcccctt
Chr16      ctccccggctggcccccaggtctgggtactggtggaactgagccaagaccattgcccctg
Chr22      ctccccggctggcccccaggtctgggtactggtggaactgagccaagaccattgcccctg
           ************ **** ********* ******************************  
             1781        .         .         .         .         .
ABCD1      cctagGTTGGGAGGCTATGTGTGACTGGAAGGACGTCCTGTCGGGTGGCGAGAAGCAGAG 1835
Chr2       cctagGTTGGGAGGCTATGTGTGACTGGAAAGATGTCCTGCCGGGTGGCGAGAAGCAGAG
Chr10      cctagGTTGGGAGGCTATGTGTGACTGGAAGGACATCCTGCCAGGTGGTGAGAAGCAGAG
Chr16      cctagGTTGGGAGGCTATGTGTGACTGGAAGGACGTCCTGCCGGGTGGCAAGAAGCAGAG
Chr22      cctagGTTGGGAGGCTATGTGTGACTGGAAGGATGTCCTGCCGGGTGGCAAGAAGCAGAG
           ****************************** **  ***** * *****  **********
               .         .         .    
ABCD1      AATCGGCATGGCCCGCATGTTCTACCACAGgtgagcactccgggccggcaggctccctgg 1865
Chr2       AATCGGCATGGCCCGCATGTTCTACCACAGgtgagcactccgggccggcaggctccctgg
Chr10      AATCGGCATGGCCCGCAAGTTCTACCACAGgtgagcactccaggctggcagcctccctgg
Chr16      AATCGGCATGGCCTGCATGTTCTACCACAGgtgagcactccaggctggcaggctccctgg
Chr22      AATCGGCATGGCCTGCATGTTCTACCACAGgtgagcactccaggctggcaggctccctgg
           ************* *** *********************** *** ***** ********

Alignment of exon 9 of the ABCD1 gene with the paralogs.

ABCD1      gggctggggtgttgggccctggagggtgcacagactctcctctcggcccggacccccagG 1866
Chr2       ggactggggtgttgggccctggagggtgcacagactctcctctcggcccggacccccagG
Chr10      gggctggggtgttgggccctggagggtgcacagactcttctctcggaccggacccacagG
Chr16      gggttggggtgttgggccctggagggtgcacagactctcctctcggcccggacccccagG
Chr22      gggttggggtgttgggccctggagggtgcacagactctcctctaggcccggacccccagG
           **  ********************************** **** ** ******** ****
              .         .         .         .         .         .
ABCD1      CCCAAGTACGCCCTCCTGGATGAATGCACCAGCGCCGTGAGCATCGACGTGGAAGGCAAG 1926
Chr2       CCCAAGTACGCCCTCCTGGATGAATGCACCAGTGCTGTGAGCATCGACGTGGAAGGCAAG
Chr10      CCCAAGTACGCCCTCCTGGATGAAGGCACCAGTGCCGTGAGCATCGACGTGGAAGGCAAG
Chr16      CCCAAGTACACCCTCCTGGATGAATGCACCAGTGCCATGAGCATCGACGTGGAAGGCAAG
Chr22      CCCAAGTACACCCTCCTGGATGAATGCACCAGTGCCGTGAGCATCGACGTGGAAGGCAAG
           ********* ************** ******* **  ***********************
              .         .         .         .         .         .
ABCD1      ATCTTCCAGGCGGCCAAGGACGCGGGCATTGCCCTGCTCTCCATCACCCACCGGCCCTCC 1986
Chr2       ATCTTCCAGGCGGCCAAGGACGCAGGCATTGCCCTGCTCTCCATCACCCACCAGCCC-TC
Chr10      ATCTTCCAGGTGGCCAAGGACGCAGGCATTGCCCTGCTCTCCATCACCCTCCAGCCCTCC
Chr16      ATCTTCCAGGCGGCCAAGGACGCAGGCATTGCCCTGCTCTCCATCACCCACCGGCCCTCC
Chr22      ATCTTCCAGGCGGCCAAGGACGCAGGCATTGCCCTGCTCTCCATCACCCACCGGCCCTCC
           ********** ************ ************************* ** ****  *
              .
ABCD1      CTGTGgtaggtgccctgtctccctgcctggggtcggtgggagtggctgcctgaggggagg 1991
Chr2       CTGTGgtaggtgccctgtctccctgcctggggtcagtgggagtggctgcctgaggggagg
Chr10      CTGTGgtaggtgccctgtctccctgcctggggtcagtgggagtggctgcctgaggggagg
Chr16      CTGTGgtaggtgccctgtctcccttcctggggtgagtgggagtggctgcctgaggggagg
Chr22      CTGTGgtaggtgccctgtctcccttcctggggtgagtgggagtggctgcctgaggggagg
           ************************ ********  *************************

Alignment of exon 10 of the ABCD1 gene with the paralogs.

ABCD1      tgcccctgaccctgtccctctcctggccagGAAATACCACACACACTTGCTACAGTTCGA 2021
Chr2       tgcccctgaccctgtccctctcctggccagGGAGTACCACACACACTTGCTACAGTTCGA
Chr10      tgcccctgaccccgtccctctcctggccagGGAGTACCACACACACTTGCTACAGTTCGA
Chr16      tgcccctgaccctgtccctctcctggccagGGAGTACCACACACACTTGCTACAGTTCGA
Chr22      tgcccctgaccctgtccctctcctggccagGGAGTACCACACACACTTGCTACAGTTCGA
           ************ ****************** * **************************
                   .         .         .         .         .         .
ABCD1      TGGGGAGGGCGGCTGGAAGTTCGAGAAGCTGGACTCAGCTGCCCGCCTGAGCCTGACGGA 2081
Chr2       TGGGGAGGGTGGCTGGAAGTTCGAGAAGCTAGGCTCGGCTGCCCGCCTGAGCCTGACAGA
Chr10      TGGGGAGGGTGGCTGGAAGTTCGAGAAGCTGGACTCAGCTGCCCACCTGAGCCTGACAGA
Chr16      TGGGGAGGGCGGCTGGAAGTTCGAGAAGCTGGACTCAGCGGCCAGCCTGAGTCTGACAGA
Chr22      TGGGGAGGGCGGCTGGAAGTTCGAGAAGCTGGACTCAGCGGCCCGCCTGAGTCTGACAGA
           ********* ******************** * *** ** ***  ****** ***** **
                   .         .         .         .         .         .
ABCD1      GGAGAAGCAGCGGCTGGAGCAGCAGCTGGCGGGCATTCCCAAGATGCAGCGGCGCCTCCA 2141
Chr2       GGAGAAGCAGCGGCTGGAGCAGCAGCTGGCGGGCATTCCCAAGATGCAGCGGCACCTCCA
Chr10      GGAGAAGCAGCGGCTGGAGCAGCAGCTGGCGGGCATTCCCAAGATGCAGCAGCACCTCCA
Chr16      GGAGAAACAGCGGCTGGAGCAGCAGCTGGCAGGCATTCCCAAGATGCAGCGGCACCTCCA
Chr22      GGAGAAGCAGCGGCTGGAGCAGCAGCTGGCAGGCATTCCCAAGATGCAGCGGCACCTCCA
           ****** *********************** ******************* ** ******
                   .         .         .         .         .         .
ABCD1      GGAGCTCTGCCAGATCCTGGGCGAGGCCGTGGCCCCAGCGCATGTGCCGGCACCTAGCCC 2201
Chr2       GGAGCTCTGCCAAATCCTGGGCGAGGCCGTGGCCCCAGCGCACGTGCCGGCACCTAGCCC
Chr10      GGAGCTCTGCCAAATCCTGGGCGAGGCCGTGGCCCCAGCGCACGTGCCGGCACCTAGCCT
Chr16      GGAGCTCTGCCAAATCCTGGGCGAGGCCGTGGCCCCAGCGCATGTGCCGGCACCTAGCCC
Chr22      GGAGCTCTGCCAAATCCTGGGCGAGGCCGTGGCCCCAGCGCATGTGCCGGCACCTAGCCC
           ************ ***************************** **************** 
                   .         .         .        
ABCD1      GCAAGGCCCTGGTGGCCTCCAGGGTGCCTCCACCTGAcacaaccgtccccggcccctgcc 2238
Chr2       GCAAGGCCCTGGTGGCCTCCAGGGTGCCTCCACCTGAcgccaccctccccagcccctgcc
Chr10      GCAAGGCCCTGGTGGACTCCAGGGTGCCTCCACCTGAccccaccctctccagccccttcc
Chr16      GCAAGGCCCTGGTGGCCTCCAGGGTGCCTCCACCTGAcgccaccctccccagcccctgcc
Chr22      GCAAGGCCCTGGTGGCCTCCAGGGTGCCTCCACCTGAcgccaccctccccagcccctgcc
           *************** ********************** * *** ** ** ****** **

ABCD1 gene specific primers

Exon/s Primer name 5′ -> 3′ Sequence nt Amplicon size (incl M13 tails)
1a ALDe1A-F TGTAAAACGACGGCCAGTACAACAGGCCCAGGGTCAGA 38 458 bp
ALDe1A-R CAGGAAACAGCTATGACCAGGAAGGTGCGGCTCACCA 37
1b ALDe1B-F TGTAAAACGACGGCCAGTAACCGGGTATTCCTGCAGCG 38 421 bp
ALDe1B-R CAGGAAACAGCTATGACCACTGGTCAGGGTTGCGAAGC 38
1c ALDe1C-F TGTAAAACGACGGCCAGTCCACGCCTACCGCCTCTACTT 39 520 bp
ALDe1C-R CAGGAAACAGCTATGACCAGACTGTCCCCACCGCTC 36
2 ALDe2-F TGTAAAACGACGGCCAGTGGCACTGGGAGACCCTG 35 368 bp
ALDe2-R CAGGAAACAGCTATGACCTCAGCACCCAGCGGTATGG 37
3 & 4 ALDe3/4-F TGTAAAACGACGGCCAGTGCAGAAGAGCCTCGCCTTTC 38 606 bp
ALDe3/4-R CAGGAAACAGCTATGACCGCAGCAGGTCAGCACCTGCA 38
5 ALDe5-F TGTAAAACGACGGCCAGTCTGCCAGGGATGGGAATGAG 38 373 bp
ALDe5-R CAGGAAACAGCTATGACCTCTCACCTTGACCTTGGCCC 38
6 ALDe6-F TGTAAAACGACGGCCAGTGCCATAGGGTACGGGAAGGG 38 312 bp
ALDe6-R CAGGAAACAGCTATGACCGCCTCTGCAGGAAGCCATGT 38
7 ALDe7-F TGTAAAACGACGGCCAGTCGATCCACTGCCCTGTTTTGG 39 527 bp
ALDe7-R CAGGAAACAGCTATGACCCTTCCCTAGAGCACCTGG 36
8 & 9 ALDe8/9-F TGTAAAACGACGGCCAGTCTGAGCCAAGACCATTGCCCCCG 41 507 bp
ALDe8/9-R CAGGAAACAGCTATGACCTGCTGCTGCCGGGCCCGC 36
10 ALDe10-F TGTAAAACGACGGCCAGTGAGGGGAGGAGGTGGCCTGGC 39 463 bp
ALDe10-R CAGGAAACAGCTATGACCGCGGGGTGCGTGCATGGGTGG 39

Primer sequences in black are M13F and M13R sequences that are used for sequencing. Nucleotides in green are Xq28, ABCD1 gene, specific. Primers were taken from Boehm et al.: Accurate DNA-based Diagnostic and Carrier Testing for X-linked Adrenoleukodystrophy (1999) Mol Genet Metab 66: 128-136.

Last modified | 2018-02-07